ID: 1048898198

View in Genome Browser
Species Human (GRCh38)
Location 8:139013652-139013674
Sequence CTGGGGCTATGAAGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048898184_1048898198 29 Left 1048898184 8:139013600-139013622 CCTAGCTCCATAGCTGCACCTGC No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data
1048898183_1048898198 30 Left 1048898183 8:139013599-139013621 CCCTAGCTCCATAGCTGCACCTG No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data
1048898189_1048898198 5 Left 1048898189 8:139013624-139013646 CCATCCACAACACCGCAGGGCAG No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data
1048898185_1048898198 22 Left 1048898185 8:139013607-139013629 CCATAGCTGCACCTGCGCCATCC No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data
1048898195_1048898198 -7 Left 1048898195 8:139013636-139013658 CCGCAGGGCAGGTATTCTGGGGC No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data
1048898191_1048898198 1 Left 1048898191 8:139013628-139013650 CCACAACACCGCAGGGCAGGTAT No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data
1048898186_1048898198 11 Left 1048898186 8:139013618-139013640 CCTGCGCCATCCACAACACCGCA No data
Right 1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048898198 Original CRISPR CTGGGGCTATGAAGGGAACC TGG Intergenic
No off target data available for this crispr