ID: 1048899266

View in Genome Browser
Species Human (GRCh38)
Location 8:139022172-139022194
Sequence AGCCCAGAGGCTCCTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048899266_1048899270 -5 Left 1048899266 8:139022172-139022194 CCCTCTGCAGGAGCCTCTGGGCT No data
Right 1048899270 8:139022190-139022212 GGGCTCAGCTCCTCTGCCCTGGG No data
1048899266_1048899269 -6 Left 1048899266 8:139022172-139022194 CCCTCTGCAGGAGCCTCTGGGCT No data
Right 1048899269 8:139022189-139022211 TGGGCTCAGCTCCTCTGCCCTGG No data
1048899266_1048899274 13 Left 1048899266 8:139022172-139022194 CCCTCTGCAGGAGCCTCTGGGCT No data
Right 1048899274 8:139022208-139022230 CTGGGAGAGAACCCATGATGTGG No data
1048899266_1048899278 25 Left 1048899266 8:139022172-139022194 CCCTCTGCAGGAGCCTCTGGGCT No data
Right 1048899278 8:139022220-139022242 CCATGATGTGGGTGTCAGCGAGG No data
1048899266_1048899275 14 Left 1048899266 8:139022172-139022194 CCCTCTGCAGGAGCCTCTGGGCT No data
Right 1048899275 8:139022209-139022231 TGGGAGAGAACCCATGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048899266 Original CRISPR AGCCCAGAGGCTCCTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr