ID: 1048900781

View in Genome Browser
Species Human (GRCh38)
Location 8:139035555-139035577
Sequence ATGCTTTTGCTGATAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048900780_1048900781 -7 Left 1048900780 8:139035539-139035561 CCACATTACTGTGATCATGCTTT No data
Right 1048900781 8:139035555-139035577 ATGCTTTTGCTGATAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048900781 Original CRISPR ATGCTTTTGCTGATAAAACA AGG Intergenic
No off target data available for this crispr