ID: 1048905457

View in Genome Browser
Species Human (GRCh38)
Location 8:139083926-139083948
Sequence CTGTGGGGAATGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048905457_1048905466 16 Left 1048905457 8:139083926-139083948 CCTTATTCCCTCATTCCCCACAG No data
Right 1048905466 8:139083965-139083987 CTCTTCCTCCTCCTGCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048905457 Original CRISPR CTGTGGGGAATGAGGGAATA AGG (reversed) Intergenic
No off target data available for this crispr