ID: 1048908941

View in Genome Browser
Species Human (GRCh38)
Location 8:139115862-139115884
Sequence AGCTGGCTCTACAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048908933_1048908941 22 Left 1048908933 8:139115817-139115839 CCTGTCTGGCAGGACATGGGTTT No data
Right 1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG No data
1048908930_1048908941 26 Left 1048908930 8:139115813-139115835 CCAACCTGTCTGGCAGGACATGG No data
Right 1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048908941 Original CRISPR AGCTGGCTCTACAGGGAAAA AGG Intergenic
No off target data available for this crispr