ID: 1048909699

View in Genome Browser
Species Human (GRCh38)
Location 8:139123301-139123323
Sequence TAATTGATGGAAAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048909694_1048909699 -2 Left 1048909694 8:139123280-139123302 CCTATGACCTACTTAGCTATATA No data
Right 1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG No data
1048909695_1048909699 -9 Left 1048909695 8:139123287-139123309 CCTACTTAGCTATATAATTGATG No data
Right 1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048909699 Original CRISPR TAATTGATGGAAAGGGAAGA TGG Intergenic
No off target data available for this crispr