ID: 1048910378

View in Genome Browser
Species Human (GRCh38)
Location 8:139129166-139129188
Sequence TTCTGGCAACCTCCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048910374_1048910378 -1 Left 1048910374 8:139129144-139129166 CCTGAGGAGAATTGGCATTCTTT No data
Right 1048910378 8:139129166-139129188 TTCTGGCAACCTCCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048910378 Original CRISPR TTCTGGCAACCTCCTCAGGG AGG Intergenic
No off target data available for this crispr