ID: 1048910751

View in Genome Browser
Species Human (GRCh38)
Location 8:139132509-139132531
Sequence CACAGGTAAGTGCCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048910751_1048910759 10 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910759 8:139132542-139132564 TACGAGGGTCAAGATGGCTGGGG No data
1048910751_1048910754 -5 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910754 8:139132527-139132549 CTGTGCTGAATCCAATACGAGGG No data
1048910751_1048910755 4 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910755 8:139132536-139132558 ATCCAATACGAGGGTCAAGATGG No data
1048910751_1048910758 9 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910758 8:139132541-139132563 ATACGAGGGTCAAGATGGCTGGG No data
1048910751_1048910753 -6 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910753 8:139132526-139132548 CCTGTGCTGAATCCAATACGAGG No data
1048910751_1048910760 26 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910760 8:139132558-139132580 GCTGGGGTAAGAGCATAACTTGG No data
1048910751_1048910757 8 Left 1048910751 8:139132509-139132531 CCTGCTGCAGGCACTTACCTGTG No data
Right 1048910757 8:139132540-139132562 AATACGAGGGTCAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048910751 Original CRISPR CACAGGTAAGTGCCTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr