ID: 1048917702

View in Genome Browser
Species Human (GRCh38)
Location 8:139200538-139200560
Sequence CAATTCCTCCAGCCTTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048917700_1048917702 0 Left 1048917700 8:139200515-139200537 CCACTTTCTGTGGATTGCCTTGT No data
Right 1048917702 8:139200538-139200560 CAATTCCTCCAGCCTTGCCTAGG No data
1048917699_1048917702 1 Left 1048917699 8:139200514-139200536 CCCACTTTCTGTGGATTGCCTTG No data
Right 1048917702 8:139200538-139200560 CAATTCCTCCAGCCTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048917702 Original CRISPR CAATTCCTCCAGCCTTGCCT AGG Intergenic
No off target data available for this crispr