ID: 1048918706

View in Genome Browser
Species Human (GRCh38)
Location 8:139208215-139208237
Sequence GAATGCACATCATTGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048918704_1048918706 10 Left 1048918704 8:139208182-139208204 CCTTCACTTGGTATGTGCTGTGT No data
Right 1048918706 8:139208215-139208237 GAATGCACATCATTGGCAGCAGG No data
1048918703_1048918706 11 Left 1048918703 8:139208181-139208203 CCCTTCACTTGGTATGTGCTGTG No data
Right 1048918706 8:139208215-139208237 GAATGCACATCATTGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048918706 Original CRISPR GAATGCACATCATTGGCAGC AGG Intergenic
No off target data available for this crispr