ID: 1048919327

View in Genome Browser
Species Human (GRCh38)
Location 8:139213520-139213542
Sequence CCCCGCGGCCGCCTCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048919327_1048919339 27 Left 1048919327 8:139213520-139213542 CCCAGGAAGAGGCGGCCGCGGGG No data
Right 1048919339 8:139213570-139213592 TCACTCTGGTCTCTAGACAGAGG No data
1048919327_1048919336 13 Left 1048919327 8:139213520-139213542 CCCAGGAAGAGGCGGCCGCGGGG No data
Right 1048919336 8:139213556-139213578 CCTCCTCCATCGTCTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048919327 Original CRISPR CCCCGCGGCCGCCTCTTCCT GGG (reversed) Intergenic