ID: 1048920641

View in Genome Browser
Species Human (GRCh38)
Location 8:139226929-139226951
Sequence GTACTCTTGTAGTAGTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048920641_1048920645 16 Left 1048920641 8:139226929-139226951 CCAAGATACTACTACAAGAGTAC No data
Right 1048920645 8:139226968-139226990 ACCCAGCTGAGAAGTTAGCAGGG No data
1048920641_1048920644 15 Left 1048920641 8:139226929-139226951 CCAAGATACTACTACAAGAGTAC No data
Right 1048920644 8:139226967-139226989 TACCCAGCTGAGAAGTTAGCAGG No data
1048920641_1048920648 30 Left 1048920641 8:139226929-139226951 CCAAGATACTACTACAAGAGTAC No data
Right 1048920648 8:139226982-139227004 TTAGCAGGGATTTCTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048920641 Original CRISPR GTACTCTTGTAGTAGTATCT TGG (reversed) Intergenic
No off target data available for this crispr