ID: 1048923175

View in Genome Browser
Species Human (GRCh38)
Location 8:139248694-139248716
Sequence GTGGCCAACAGGAATGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048923168_1048923175 -3 Left 1048923168 8:139248674-139248696 CCATAAGCAGTCCTAGACCAGTG No data
Right 1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG No data
1048923166_1048923175 13 Left 1048923166 8:139248658-139248680 CCAGGGATAGTGGGACCCATAAG No data
Right 1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG No data
1048923163_1048923175 24 Left 1048923163 8:139248647-139248669 CCTGATGATAGCCAGGGATAGTG No data
Right 1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG No data
1048923167_1048923175 -2 Left 1048923167 8:139248673-139248695 CCCATAAGCAGTCCTAGACCAGT No data
Right 1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048923175 Original CRISPR GTGGCCAACAGGAATGAGAG GGG Intergenic
No off target data available for this crispr