ID: 1048925151

View in Genome Browser
Species Human (GRCh38)
Location 8:139264893-139264915
Sequence CTTGCTGGGCTGCAACCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048925151_1048925156 9 Left 1048925151 8:139264893-139264915 CCCTCAGGTTGCAGCCCAGCAAG No data
Right 1048925156 8:139264925-139264947 CGCATTCCATTTCCTCCTGACGG No data
1048925151_1048925157 13 Left 1048925151 8:139264893-139264915 CCCTCAGGTTGCAGCCCAGCAAG No data
Right 1048925157 8:139264929-139264951 TTCCATTTCCTCCTGACGGCAGG No data
1048925151_1048925160 18 Left 1048925151 8:139264893-139264915 CCCTCAGGTTGCAGCCCAGCAAG No data
Right 1048925160 8:139264934-139264956 TTTCCTCCTGACGGCAGGTAGGG No data
1048925151_1048925161 19 Left 1048925151 8:139264893-139264915 CCCTCAGGTTGCAGCCCAGCAAG No data
Right 1048925161 8:139264935-139264957 TTCCTCCTGACGGCAGGTAGGGG No data
1048925151_1048925159 17 Left 1048925151 8:139264893-139264915 CCCTCAGGTTGCAGCCCAGCAAG No data
Right 1048925159 8:139264933-139264955 ATTTCCTCCTGACGGCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048925151 Original CRISPR CTTGCTGGGCTGCAACCTGA GGG (reversed) Intergenic
No off target data available for this crispr