ID: 1048926378

View in Genome Browser
Species Human (GRCh38)
Location 8:139276176-139276198
Sequence TTTGCAAATTTGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048926378_1048926385 23 Left 1048926378 8:139276176-139276198 CCCACCACCTTCAAATTTGCAAA No data
Right 1048926385 8:139276222-139276244 AGTAAGTACTCCCTAAAACAGGG No data
1048926378_1048926384 22 Left 1048926378 8:139276176-139276198 CCCACCACCTTCAAATTTGCAAA No data
Right 1048926384 8:139276221-139276243 TAGTAAGTACTCCCTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048926378 Original CRISPR TTTGCAAATTTGAAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr