ID: 1048926942

View in Genome Browser
Species Human (GRCh38)
Location 8:139279946-139279968
Sequence GAATCACTTTGATTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048926942_1048926948 11 Left 1048926942 8:139279946-139279968 CCTGGCCTCAATCAAAGTGATTC No data
Right 1048926948 8:139279980-139280002 GCTCCTCTTGTAGCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048926942 Original CRISPR GAATCACTTTGATTGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr