ID: 1048926948

View in Genome Browser
Species Human (GRCh38)
Location 8:139279980-139280002
Sequence GCTCCTCTTGTAGCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048926942_1048926948 11 Left 1048926942 8:139279946-139279968 CCTGGCCTCAATCAAAGTGATTC No data
Right 1048926948 8:139279980-139280002 GCTCCTCTTGTAGCTCCCACTGG No data
1048926943_1048926948 6 Left 1048926943 8:139279951-139279973 CCTCAATCAAAGTGATTCATCCA No data
Right 1048926948 8:139279980-139280002 GCTCCTCTTGTAGCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048926948 Original CRISPR GCTCCTCTTGTAGCTCCCAC TGG Intergenic
No off target data available for this crispr