ID: 1048930944

View in Genome Browser
Species Human (GRCh38)
Location 8:139315094-139315116
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048930940_1048930944 4 Left 1048930940 8:139315067-139315089 CCTGAAATAACAGTCTAGGTGGT No data
Right 1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048930944 Original CRISPR CACAGCTAACAGAAGCATGG TGG Intergenic
No off target data available for this crispr