ID: 1048931385

View in Genome Browser
Species Human (GRCh38)
Location 8:139318207-139318229
Sequence TGTCCAATTCTTAAAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048931383_1048931385 9 Left 1048931383 8:139318175-139318197 CCTAGGAAGAGAGAATGATATAA No data
Right 1048931385 8:139318207-139318229 TGTCCAATTCTTAAAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048931385 Original CRISPR TGTCCAATTCTTAAAGCAGG TGG Intergenic
No off target data available for this crispr