ID: 1048932239

View in Genome Browser
Species Human (GRCh38)
Location 8:139324393-139324415
Sequence CCAAAGCCTGCATTTAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048932231_1048932239 24 Left 1048932231 8:139324346-139324368 CCTGGGGCTGAAGAGCACTCAGG No data
Right 1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG No data
1048932230_1048932239 30 Left 1048932230 8:139324340-139324362 CCAAAGCCTGGGGCTGAAGAGCA No data
Right 1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048932239 Original CRISPR CCAAAGCCTGCATTTAGATG AGG Intergenic
No off target data available for this crispr