ID: 1048933473

View in Genome Browser
Species Human (GRCh38)
Location 8:139335957-139335979
Sequence TCAGTACAAGGCATGGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048933473_1048933484 21 Left 1048933473 8:139335957-139335979 CCGGACCCCATGCCTTGTACTGA No data
Right 1048933484 8:139336001-139336023 TCTTTTTGCAGGGCCAGTTGAGG No data
1048933473_1048933482 10 Left 1048933473 8:139335957-139335979 CCGGACCCCATGCCTTGTACTGA No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933473_1048933483 11 Left 1048933473 8:139335957-139335979 CCGGACCCCATGCCTTGTACTGA No data
Right 1048933483 8:139335991-139336013 TTGCTACAGATCTTTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048933473 Original CRISPR TCAGTACAAGGCATGGGGTC CGG (reversed) Intergenic
No off target data available for this crispr