ID: 1048933480

View in Genome Browser
Species Human (GRCh38)
Location 8:139335969-139335991
Sequence AGTGATGGCCCCTCAGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048933480_1048933483 -1 Left 1048933480 8:139335969-139335991 CCTTGTACTGAGGGGCCATCACT No data
Right 1048933483 8:139335991-139336013 TTGCTACAGATCTTTTTGCAGGG No data
1048933480_1048933482 -2 Left 1048933480 8:139335969-139335991 CCTTGTACTGAGGGGCCATCACT No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933480_1048933484 9 Left 1048933480 8:139335969-139335991 CCTTGTACTGAGGGGCCATCACT No data
Right 1048933484 8:139336001-139336023 TCTTTTTGCAGGGCCAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048933480 Original CRISPR AGTGATGGCCCCTCAGTACA AGG (reversed) Intergenic
No off target data available for this crispr