ID: 1048933482

View in Genome Browser
Species Human (GRCh38)
Location 8:139335990-139336012
Sequence CTTGCTACAGATCTTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048933477_1048933482 5 Left 1048933477 8:139335962-139335984 CCCCATGCCTTGTACTGAGGGGC No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933478_1048933482 4 Left 1048933478 8:139335963-139335985 CCCATGCCTTGTACTGAGGGGCC No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933473_1048933482 10 Left 1048933473 8:139335957-139335979 CCGGACCCCATGCCTTGTACTGA No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933472_1048933482 11 Left 1048933472 8:139335956-139335978 CCCGGACCCCATGCCTTGTACTG No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933480_1048933482 -2 Left 1048933480 8:139335969-139335991 CCTTGTACTGAGGGGCCATCACT No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data
1048933479_1048933482 3 Left 1048933479 8:139335964-139335986 CCATGCCTTGTACTGAGGGGCCA No data
Right 1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048933482 Original CRISPR CTTGCTACAGATCTTTTTGC AGG Intergenic
No off target data available for this crispr