ID: 1048936273

View in Genome Browser
Species Human (GRCh38)
Location 8:139359786-139359808
Sequence TACTACTTATATAAAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048936271_1048936273 7 Left 1048936271 8:139359756-139359778 CCATAAACGGATATCTAGGGGAT No data
Right 1048936273 8:139359786-139359808 TACTACTTATATAAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048936273 Original CRISPR TACTACTTATATAAAGTGTG TGG Intergenic
No off target data available for this crispr