ID: 1048940028

View in Genome Browser
Species Human (GRCh38)
Location 8:139392540-139392562
Sequence CCAGGACTGGTAGAGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048940028_1048940034 21 Left 1048940028 8:139392540-139392562 CCATTACTCTCTACCAGTCCTGG No data
Right 1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG No data
1048940028_1048940032 6 Left 1048940028 8:139392540-139392562 CCATTACTCTCTACCAGTCCTGG No data
Right 1048940032 8:139392569-139392591 TTTCCTCACAGCTCTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048940028 Original CRISPR CCAGGACTGGTAGAGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr