ID: 1048940030

View in Genome Browser
Species Human (GRCh38)
Location 8:139392553-139392575
Sequence GAGGAAAAGTACACCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048940030_1048940032 -7 Left 1048940030 8:139392553-139392575 CCAGTCCTGGTGTACTTTTCCTC No data
Right 1048940032 8:139392569-139392591 TTTCCTCACAGCTCTTACCCAGG No data
1048940030_1048940041 27 Left 1048940030 8:139392553-139392575 CCAGTCCTGGTGTACTTTTCCTC No data
Right 1048940041 8:139392603-139392625 CAGGCACTAGACCCAGAGCAAGG No data
1048940030_1048940034 8 Left 1048940030 8:139392553-139392575 CCAGTCCTGGTGTACTTTTCCTC No data
Right 1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048940030 Original CRISPR GAGGAAAAGTACACCAGGAC TGG (reversed) Intergenic
No off target data available for this crispr