ID: 1048940031

View in Genome Browser
Species Human (GRCh38)
Location 8:139392558-139392580
Sequence GCTGTGAGGAAAAGTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048940031_1048940041 22 Left 1048940031 8:139392558-139392580 CCTGGTGTACTTTTCCTCACAGC No data
Right 1048940041 8:139392603-139392625 CAGGCACTAGACCCAGAGCAAGG No data
1048940031_1048940034 3 Left 1048940031 8:139392558-139392580 CCTGGTGTACTTTTCCTCACAGC No data
Right 1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048940031 Original CRISPR GCTGTGAGGAAAAGTACACC AGG (reversed) Intergenic
No off target data available for this crispr