ID: 1048940034

View in Genome Browser
Species Human (GRCh38)
Location 8:139392584-139392606
Sequence TACCCAGGTCAGCCCCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048940028_1048940034 21 Left 1048940028 8:139392540-139392562 CCATTACTCTCTACCAGTCCTGG No data
Right 1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG No data
1048940031_1048940034 3 Left 1048940031 8:139392558-139392580 CCTGGTGTACTTTTCCTCACAGC No data
Right 1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG No data
1048940030_1048940034 8 Left 1048940030 8:139392553-139392575 CCAGTCCTGGTGTACTTTTCCTC No data
Right 1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048940034 Original CRISPR TACCCAGGTCAGCCCCCAAC AGG Intergenic
No off target data available for this crispr