ID: 1048941464

View in Genome Browser
Species Human (GRCh38)
Location 8:139404138-139404160
Sequence GTGCAGAAGCAGAGTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048941457_1048941464 22 Left 1048941457 8:139404093-139404115 CCAGCACTGTGAAGAAAGCCCAC No data
Right 1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG No data
1048941459_1048941464 3 Left 1048941459 8:139404112-139404134 CCACCATGTTCTGCATCTTTATC No data
Right 1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG No data
1048941460_1048941464 0 Left 1048941460 8:139404115-139404137 CCATGTTCTGCATCTTTATCCCA No data
Right 1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG No data
1048941458_1048941464 4 Left 1048941458 8:139404111-139404133 CCCACCATGTTCTGCATCTTTAT No data
Right 1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048941464 Original CRISPR GTGCAGAAGCAGAGTGATGT GGG Intergenic
No off target data available for this crispr