ID: 1048941572

View in Genome Browser
Species Human (GRCh38)
Location 8:139404715-139404737
Sequence CTGTGGCTATAGTGGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048941566_1048941572 20 Left 1048941566 8:139404672-139404694 CCATTCGGTGCGTTTTGATCTCA No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data
1048941565_1048941572 24 Left 1048941565 8:139404668-139404690 CCAACCATTCGGTGCGTTTTGAT No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data
1048941570_1048941572 -7 Left 1048941570 8:139404699-139404721 CCTGGAGAGAGACTCACTGTGGC No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data
1048941564_1048941572 25 Left 1048941564 8:139404667-139404689 CCCAACCATTCGGTGCGTTTTGA No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data
1048941562_1048941572 29 Left 1048941562 8:139404663-139404685 CCACCCCAACCATTCGGTGCGTT No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data
1048941568_1048941572 -6 Left 1048941568 8:139404698-139404720 CCCTGGAGAGAGACTCACTGTGG No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data
1048941563_1048941572 26 Left 1048941563 8:139404666-139404688 CCCCAACCATTCGGTGCGTTTTG No data
Right 1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048941572 Original CRISPR CTGTGGCTATAGTGGAGAAA AGG Intergenic
No off target data available for this crispr