ID: 1048943271

View in Genome Browser
Species Human (GRCh38)
Location 8:139421315-139421337
Sequence TCTTACATGGCCGTGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048943268_1048943271 19 Left 1048943268 8:139421273-139421295 CCAGCAATGAACGTGCACTACAT No data
Right 1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048943271 Original CRISPR TCTTACATGGCCGTGGTTCA TGG Intergenic
No off target data available for this crispr