ID: 1048943343

View in Genome Browser
Species Human (GRCh38)
Location 8:139422181-139422203
Sequence CTGAGGAGCTCAAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048943343_1048943347 19 Left 1048943343 8:139422181-139422203 CCTGGACACTTTGAGCTCCTCAG No data
Right 1048943347 8:139422223-139422245 TCTAGTATAATTGTACTGGCTGG No data
1048943343_1048943346 15 Left 1048943343 8:139422181-139422203 CCTGGACACTTTGAGCTCCTCAG No data
Right 1048943346 8:139422219-139422241 CAAATCTAGTATAATTGTACTGG No data
1048943343_1048943344 -8 Left 1048943343 8:139422181-139422203 CCTGGACACTTTGAGCTCCTCAG No data
Right 1048943344 8:139422196-139422218 CTCCTCAGTCTCTGACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048943343 Original CRISPR CTGAGGAGCTCAAAGTGTCC AGG (reversed) Intergenic
No off target data available for this crispr