ID: 1048950790

View in Genome Browser
Species Human (GRCh38)
Location 8:139495334-139495356
Sequence GGCTGTGCACCTTGCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950790_1048950798 8 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
1048950790_1048950802 20 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950790_1048950805 26 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950805 8:139495383-139495405 ACAGGATGCTAAAGGGGCAAGGG No data
1048950790_1048950800 18 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950800 8:139495375-139495397 GAAAACCAACAGGATGCTAAAGG No data
1048950790_1048950801 19 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950801 8:139495376-139495398 AAAACCAACAGGATGCTAAAGGG No data
1048950790_1048950791 -4 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950791 8:139495353-139495375 AGCCACTGCCCCCCTCAGCCTGG No data
1048950790_1048950804 25 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950790_1048950806 30 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950790 Original CRISPR GGCTGTGCACCTTGCTGAGC AGG (reversed) Intergenic
No off target data available for this crispr