ID: 1048950792

View in Genome Browser
Species Human (GRCh38)
Location 8:139495355-139495377
Sequence TTCCAGGCTGAGGGGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950792_1048950804 4 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950792_1048950801 -2 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950801 8:139495376-139495398 AAAACCAACAGGATGCTAAAGGG No data
1048950792_1048950805 5 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950805 8:139495383-139495405 ACAGGATGCTAAAGGGGCAAGGG No data
1048950792_1048950808 16 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950808 8:139495394-139495416 AAGGGGCAAGGGCAGGTAATGGG No data
1048950792_1048950809 22 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950809 8:139495400-139495422 CAAGGGCAGGTAATGGGCTGCGG No data
1048950792_1048950807 15 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950807 8:139495393-139495415 AAAGGGGCAAGGGCAGGTAATGG No data
1048950792_1048950810 23 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950810 8:139495401-139495423 AAGGGCAGGTAATGGGCTGCGGG No data
1048950792_1048950800 -3 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950800 8:139495375-139495397 GAAAACCAACAGGATGCTAAAGG No data
1048950792_1048950806 9 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950792_1048950802 -1 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950792 Original CRISPR TTCCAGGCTGAGGGGGGCAG TGG (reversed) Intergenic