ID: 1048950794

View in Genome Browser
Species Human (GRCh38)
Location 8:139495362-139495384
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950794_1048950808 9 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950808 8:139495394-139495416 AAGGGGCAAGGGCAGGTAATGGG No data
1048950794_1048950801 -9 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950801 8:139495376-139495398 AAAACCAACAGGATGCTAAAGGG No data
1048950794_1048950802 -8 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950794_1048950805 -2 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950805 8:139495383-139495405 ACAGGATGCTAAAGGGGCAAGGG No data
1048950794_1048950810 16 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950810 8:139495401-139495423 AAGGGCAGGTAATGGGCTGCGGG No data
1048950794_1048950811 25 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950811 8:139495410-139495432 TAATGGGCTGCGGGCCCAGATGG No data
1048950794_1048950806 2 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950794_1048950800 -10 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950800 8:139495375-139495397 GAAAACCAACAGGATGCTAAAGG No data
1048950794_1048950809 15 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950809 8:139495400-139495422 CAAGGGCAGGTAATGGGCTGCGG No data
1048950794_1048950807 8 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950807 8:139495393-139495415 AAAGGGGCAAGGGCAGGTAATGG No data
1048950794_1048950804 -3 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950794 Original CRISPR GTTGGTTTTCCAGGCTGAGG GGG (reversed) Intergenic