ID: 1048950796

View in Genome Browser
Species Human (GRCh38)
Location 8:139495364-139495386
Sequence CTGTTGGTTTTCCAGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950796_1048950805 -4 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950805 8:139495383-139495405 ACAGGATGCTAAAGGGGCAAGGG No data
1048950796_1048950802 -10 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950796_1048950804 -5 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950796_1048950807 6 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950807 8:139495393-139495415 AAAGGGGCAAGGGCAGGTAATGG No data
1048950796_1048950810 14 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950810 8:139495401-139495423 AAGGGCAGGTAATGGGCTGCGGG No data
1048950796_1048950811 23 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950811 8:139495410-139495432 TAATGGGCTGCGGGCCCAGATGG No data
1048950796_1048950808 7 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950808 8:139495394-139495416 AAGGGGCAAGGGCAGGTAATGGG No data
1048950796_1048950806 0 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950796_1048950809 13 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950809 8:139495400-139495422 CAAGGGCAGGTAATGGGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950796 Original CRISPR CTGTTGGTTTTCCAGGCTGA GGG (reversed) Intergenic