ID: 1048950798

View in Genome Browser
Species Human (GRCh38)
Location 8:139495365-139495387
Sequence CCTCAGCCTGGAAAACCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950787_1048950798 16 Left 1048950787 8:139495326-139495348 CCCTCCAGCCTGCTCAGCAAGGT No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
1048950785_1048950798 17 Left 1048950785 8:139495325-139495347 CCCCTCCAGCCTGCTCAGCAAGG No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
1048950790_1048950798 8 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
1048950784_1048950798 22 Left 1048950784 8:139495320-139495342 CCTCTCCCCTCCAGCCTGCTCAG No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
1048950788_1048950798 15 Left 1048950788 8:139495327-139495349 CCTCCAGCCTGCTCAGCAAGGTG No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
1048950789_1048950798 12 Left 1048950789 8:139495330-139495352 CCAGCCTGCTCAGCAAGGTGCAC No data
Right 1048950798 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950798 Original CRISPR CCTCAGCCTGGAAAACCAAC AGG Intergenic
No off target data available for this crispr