ID: 1048950799

View in Genome Browser
Species Human (GRCh38)
Location 8:139495371-139495393
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950799_1048950811 16 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950811 8:139495410-139495432 TAATGGGCTGCGGGCCCAGATGG No data
1048950799_1048950806 -7 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950799_1048950808 0 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950808 8:139495394-139495416 AAGGGGCAAGGGCAGGTAATGGG No data
1048950799_1048950807 -1 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950807 8:139495393-139495415 AAAGGGGCAAGGGCAGGTAATGG No data
1048950799_1048950809 6 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950809 8:139495400-139495422 CAAGGGCAGGTAATGGGCTGCGG No data
1048950799_1048950810 7 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950810 8:139495401-139495423 AAGGGCAGGTAATGGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950799 Original CRISPR TAGCATCCTGTTGGTTTTCC AGG (reversed) Intergenic