ID: 1048950802

View in Genome Browser
Species Human (GRCh38)
Location 8:139495377-139495399
Sequence AAACCAACAGGATGCTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950794_1048950802 -8 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950796_1048950802 -10 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950788_1048950802 27 Left 1048950788 8:139495327-139495349 CCTCCAGCCTGCTCAGCAAGGTG No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950790_1048950802 20 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950792_1048950802 -1 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950793_1048950802 -7 Left 1048950793 8:139495361-139495383 CCCCCCTCAGCCTGGAAAACCAA No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950787_1048950802 28 Left 1048950787 8:139495326-139495348 CCCTCCAGCCTGCTCAGCAAGGT No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950795_1048950802 -9 Left 1048950795 8:139495363-139495385 CCCCTCAGCCTGGAAAACCAACA No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950789_1048950802 24 Left 1048950789 8:139495330-139495352 CCAGCCTGCTCAGCAAGGTGCAC No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data
1048950785_1048950802 29 Left 1048950785 8:139495325-139495347 CCCCTCCAGCCTGCTCAGCAAGG No data
Right 1048950802 8:139495377-139495399 AAACCAACAGGATGCTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950802 Original CRISPR AAACCAACAGGATGCTAAAG GGG Intergenic
No off target data available for this crispr