ID: 1048950804

View in Genome Browser
Species Human (GRCh38)
Location 8:139495382-139495404
Sequence AACAGGATGCTAAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950789_1048950804 29 Left 1048950789 8:139495330-139495352 CCAGCCTGCTCAGCAAGGTGCAC No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950796_1048950804 -5 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950792_1048950804 4 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950794_1048950804 -3 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950793_1048950804 -2 Left 1048950793 8:139495361-139495383 CCCCCCTCAGCCTGGAAAACCAA No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950795_1048950804 -4 Left 1048950795 8:139495363-139495385 CCCCTCAGCCTGGAAAACCAACA No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950790_1048950804 25 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data
1048950797_1048950804 -6 Left 1048950797 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
Right 1048950804 8:139495382-139495404 AACAGGATGCTAAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950804 Original CRISPR AACAGGATGCTAAAGGGGCA AGG Intergenic
No off target data available for this crispr