ID: 1048950806

View in Genome Browser
Species Human (GRCh38)
Location 8:139495387-139495409
Sequence GATGCTAAAGGGGCAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048950795_1048950806 1 Left 1048950795 8:139495363-139495385 CCCCTCAGCCTGGAAAACCAACA No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950796_1048950806 0 Left 1048950796 8:139495364-139495386 CCCTCAGCCTGGAAAACCAACAG No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950790_1048950806 30 Left 1048950790 8:139495334-139495356 CCTGCTCAGCAAGGTGCACAGCC No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950799_1048950806 -7 Left 1048950799 8:139495371-139495393 CCTGGAAAACCAACAGGATGCTA No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950792_1048950806 9 Left 1048950792 8:139495355-139495377 CCACTGCCCCCCTCAGCCTGGAA No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950793_1048950806 3 Left 1048950793 8:139495361-139495383 CCCCCCTCAGCCTGGAAAACCAA No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950794_1048950806 2 Left 1048950794 8:139495362-139495384 CCCCCTCAGCCTGGAAAACCAAC No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data
1048950797_1048950806 -1 Left 1048950797 8:139495365-139495387 CCTCAGCCTGGAAAACCAACAGG No data
Right 1048950806 8:139495387-139495409 GATGCTAAAGGGGCAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048950806 Original CRISPR GATGCTAAAGGGGCAAGGGC AGG Intergenic