ID: 1048951277

View in Genome Browser
Species Human (GRCh38)
Location 8:139498909-139498931
Sequence CTACACACACAGATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048951277_1048951282 11 Left 1048951277 8:139498909-139498931 CCTTGCCCCATCTGTGTGTGTAG No data
Right 1048951282 8:139498943-139498965 GAAGCTTAACTGAAGTCTAAAGG No data
1048951277_1048951284 27 Left 1048951277 8:139498909-139498931 CCTTGCCCCATCTGTGTGTGTAG No data
Right 1048951284 8:139498959-139498981 CTAAAGGAGGCCACCGAACCTGG No data
1048951277_1048951283 14 Left 1048951277 8:139498909-139498931 CCTTGCCCCATCTGTGTGTGTAG No data
Right 1048951283 8:139498946-139498968 GCTTAACTGAAGTCTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048951277 Original CRISPR CTACACACACAGATGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr