ID: 1048951751

View in Genome Browser
Species Human (GRCh38)
Location 8:139502237-139502259
Sequence GCAGACATGCAGATGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048951751_1048951755 15 Left 1048951751 8:139502237-139502259 CCCTACACCATCTGCATGTCTGC No data
Right 1048951755 8:139502275-139502297 TGCTGTTTAGAATGAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048951751 Original CRISPR GCAGACATGCAGATGGTGTA GGG (reversed) Intergenic
No off target data available for this crispr