ID: 1048952211

View in Genome Browser
Species Human (GRCh38)
Location 8:139505477-139505499
Sequence TCCTATAGCCATACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048952204_1048952211 19 Left 1048952204 8:139505435-139505457 CCAAGCTGGTTCTGGTGTGGTTT No data
Right 1048952211 8:139505477-139505499 TCCTATAGCCATACTGGGGTGGG No data
1048952202_1048952211 21 Left 1048952202 8:139505433-139505455 CCCCAAGCTGGTTCTGGTGTGGT No data
Right 1048952211 8:139505477-139505499 TCCTATAGCCATACTGGGGTGGG No data
1048952203_1048952211 20 Left 1048952203 8:139505434-139505456 CCCAAGCTGGTTCTGGTGTGGTT No data
Right 1048952211 8:139505477-139505499 TCCTATAGCCATACTGGGGTGGG No data
1048952198_1048952211 28 Left 1048952198 8:139505426-139505448 CCTACCTCCCCAAGCTGGTTCTG No data
Right 1048952211 8:139505477-139505499 TCCTATAGCCATACTGGGGTGGG No data
1048952200_1048952211 24 Left 1048952200 8:139505430-139505452 CCTCCCCAAGCTGGTTCTGGTGT No data
Right 1048952211 8:139505477-139505499 TCCTATAGCCATACTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048952211 Original CRISPR TCCTATAGCCATACTGGGGT GGG Intergenic
No off target data available for this crispr