ID: 1048957208

View in Genome Browser
Species Human (GRCh38)
Location 8:139546988-139547010
Sequence CCAGTTCACCATTTCTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048957208_1048957212 -10 Left 1048957208 8:139546988-139547010 CCTAGGGAGAAATGGTGAACTGG No data
Right 1048957212 8:139547001-139547023 GGTGAACTGGGGAGAATAACAGG No data
1048957208_1048957213 -9 Left 1048957208 8:139546988-139547010 CCTAGGGAGAAATGGTGAACTGG No data
Right 1048957213 8:139547002-139547024 GTGAACTGGGGAGAATAACAGGG No data
1048957208_1048957214 8 Left 1048957208 8:139546988-139547010 CCTAGGGAGAAATGGTGAACTGG No data
Right 1048957214 8:139547019-139547041 ACAGGGCATCTCTTTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048957208 Original CRISPR CCAGTTCACCATTTCTCCCT AGG (reversed) Intergenic
No off target data available for this crispr