ID: 1048957373

View in Genome Browser
Species Human (GRCh38)
Location 8:139548132-139548154
Sequence AAGGGCCGATTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048957373_1048957379 8 Left 1048957373 8:139548132-139548154 CCCCCAGAGTTCAATCGGCCCTT No data
Right 1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112
1048957373_1048957380 12 Left 1048957373 8:139548132-139548154 CCCCCAGAGTTCAATCGGCCCTT No data
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048957373 Original CRISPR AAGGGCCGATTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr