ID: 1048957379

View in Genome Browser
Species Human (GRCh38)
Location 8:139548163-139548185
Sequence ATAATGCTCCATGCACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 7, 1: 28, 2: 40, 3: 30, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048957375_1048957379 6 Left 1048957375 8:139548134-139548156 CCCAGAGTTCAATCGGCCCTTTT No data
Right 1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112
1048957376_1048957379 5 Left 1048957376 8:139548135-139548157 CCAGAGTTCAATCGGCCCTTTTC No data
Right 1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112
1048957373_1048957379 8 Left 1048957373 8:139548132-139548154 CCCCCAGAGTTCAATCGGCCCTT No data
Right 1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112
1048957377_1048957379 -10 Left 1048957377 8:139548150-139548172 CCCTTTTCTTTATATAATGCTCC 0: 14
1: 19
2: 24
3: 115
4: 735
Right 1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112
1048957374_1048957379 7 Left 1048957374 8:139548133-139548155 CCCCAGAGTTCAATCGGCCCTTT No data
Right 1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048957379 Original CRISPR ATAATGCTCCATGCACTTGA AGG Intergenic
902986622 1:20158423-20158445 ATAATGCCCCATGCACTTGGAGG - Intergenic
905746815 1:40425200-40425222 AAAATGTTCCATGCTCTTGTAGG - Intergenic
906693447 1:47808578-47808600 ACAATGCTCCATGTAATTGGGGG - Intronic
909855802 1:80529487-80529509 CTAATTCTCCATTCCCTTGAAGG + Intergenic
911912248 1:103651568-103651590 ACAATGCTCCACATACTTGAAGG + Intergenic
911916206 1:103700380-103700402 ACAATGCTCCACATACTTGAAGG - Intronic
911919663 1:103745706-103745728 ACAATGCTCCACATACTTGAAGG + Intronic
911973363 1:104463757-104463779 ATAATGCCCCATGCACTTGGAGG + Intergenic
914980580 1:152411114-152411136 AAAATGCTCTCTACACTTGAGGG - Intronic
916102977 1:161408714-161408736 ATAATTTTTCATGCACTTGGAGG + Intergenic
916552618 1:165863167-165863189 ATAAGGATTTATGCACTTGAGGG + Intronic
918647197 1:186918377-186918399 ATAATGCTCCATGCACTTGGAGG + Intronic
921201152 1:212807747-212807769 GTACTGCTGCATGCATTTGATGG + Exonic
923245692 1:232129997-232130019 ATAATTCTCTATGCACTTCTAGG + Intergenic
1064397228 10:14991699-14991721 ATCACGCTACATGCACTTGAAGG + Intergenic
1064400126 10:15014169-15014191 ATCACGCTCCATGCACTTGAAGG + Intergenic
1065972158 10:30814113-30814135 ATAATACCCCATGCACTTGGAGG + Intergenic
1066390396 10:34973460-34973482 ATCATGTTCCATGCACTTGAAGG - Intergenic
1067678297 10:48406448-48406470 GTCATACTCCATGCAGTTGAAGG - Intronic
1068297386 10:55090594-55090616 CTCCTGTTCCATGCACTTGAGGG + Intronic
1071282216 10:84113175-84113197 ATAATGCTGCATGCACTTGGAGG - Intergenic
1072858084 10:98970819-98970841 ATAAAGCTCAAGGTACTTGAGGG + Intronic
1076453316 10:130572132-130572154 AAAATTCTACTTGCACTTGAAGG + Intergenic
1077589040 11:3477552-3477574 ATAATGCTCCACGCACTTGAAGG + Intergenic
1083808629 11:65089680-65089702 AAAATGCTCCAAGCACCTGAAGG - Intronic
1084227717 11:67727678-67727700 ATCATGGTCCATGCACTTGAAGG + Intergenic
1084244735 11:67849175-67849197 ATAATGCTCCACGCACTTGAAGG + Intergenic
1084261123 11:67979365-67979387 ATCACGCTCCATGCATGTGAAGG + Intergenic
1084807512 11:71589189-71589211 ATCACACTCCAGGCACTTGAAGG - Intronic
1084811525 11:71614730-71614752 ATCACGCTCCATGCACGTGAAGG - Intergenic
1084827951 11:71745381-71745403 ATAATGCTCCACGCACCTGAAGG - Intergenic
1084844607 11:71889194-71889216 ATCACGCTCCATGAACTTGAAGG - Intronic
1084847458 11:71911652-71911674 ATCACGCTCCATGCACTTGAAGG - Intronic
1086057501 11:82664208-82664230 GTAATGCTTTATGCACTTTAGGG - Intergenic
1091261173 11:134235354-134235376 ACAATGCTCTCTGCTCTTGAGGG - Intronic
1091962782 12:4712644-4712666 TTCATGCTCCACGCAGTTGAGGG - Intronic
1092415299 12:8286320-8286342 ATAATGCTCCACGCACTTGAAGG + Intergenic
1092432383 12:8419921-8419943 ATCACGCTCCATGCACTTGAAGG + Intergenic
1093129043 12:15367810-15367832 AGACTGCTCCATGGACCTGACGG + Intronic
1093289291 12:17301585-17301607 ATAATGCCCCATGCACTTGGAGG - Intergenic
1096509012 12:52116887-52116909 ATAATGCTCCATGCACTTGAAGG + Intergenic
1098748635 12:74269034-74269056 ATAATGCTCCATGCACTTGGAGG - Intergenic
1098814509 12:75141097-75141119 ATAACCCACCATACACTTGAAGG + Intronic
1099175390 12:79415572-79415594 ATTATGGTCCATTCACTCGAGGG - Intronic
1101029256 12:100643899-100643921 ATAATGCTCCACGAACTTGGAGG + Intergenic
1104292904 12:127485553-127485575 ATAATGCCCCATGCATTTGGAGG - Intergenic
1105568342 13:21574369-21574391 AAAATGCTCCATGGATTTCAAGG + Intronic
1107490509 13:40876655-40876677 ATAATGCTCCATGCACTTGGAGG + Intergenic
1107544163 13:41421487-41421509 ATCACGCTCCATGCACTTGAAGG + Intergenic
1109786375 13:67180931-67180953 ATAATGCTTATTGCAGTTGATGG - Intronic
1109802995 13:67401898-67401920 ATAATGCTCCATGCACTTGGAGG - Intergenic
1111179843 13:84650120-84650142 AAAATTCTCCATACCCTTGAAGG - Intergenic
1112377820 13:98860382-98860404 GTAACGCTCCATGCTCTTGTGGG - Intronic
1113771671 13:112913609-112913631 AGCCTGCCCCATGCACTTGAAGG - Intronic
1117038789 14:51751652-51751674 GTCACACTCCATGCACTTGAAGG - Intergenic
1120991547 14:90382162-90382184 CTAATGCTCCATACACTTAAGGG + Intergenic
1121515390 14:94546265-94546287 ATGATGTTCCATGGACTAGAAGG - Intergenic
1123211635 14:106766676-106766698 ATAAGGCTACTTGCACTGGATGG + Intergenic
1123995381 15:25714314-25714336 AGGATGCTCCAGGCACTTGGAGG + Intronic
1124356159 15:28996382-28996404 ATACTGCTCCATGCACAGGGAGG - Intronic
1127096312 15:55515120-55515142 ATAATGCTCCACGCACTTGGAGG + Intergenic
1130793500 15:87182043-87182065 ATAATGCTCCATGAAATAAAAGG - Intergenic
1131250108 15:90824887-90824909 AGAATAATACATGCACTTGAGGG - Intergenic
1132912782 16:2323973-2323995 ACAATGCTAGATGGACTTGATGG + Intronic
1136087787 16:27897897-27897919 AGAATGCTCCAAGAACTAGATGG - Intronic
1136660650 16:31757998-31758020 ATAATGTTCCAAACTCTTGAGGG + Intronic
1143933575 17:10457775-10457797 GTTATGCTCCATGTAATTGATGG + Intronic
1145864850 17:28234527-28234549 ATAATGCTCCATGCACTTGAAGG + Intergenic
1151754899 17:76068753-76068775 ATAATTCTCCCTGCACTAAAGGG - Intronic
1156049177 18:32911240-32911262 ATCATGCTCCATGCTCTCAAAGG + Intergenic
1160342464 18:78101547-78101569 AGAATGCTTGATGCACTGGAGGG - Intergenic
1162044473 19:7989263-7989285 GTAAAGCTCCAGTCACTTGAAGG + Intronic
1163536685 19:17880963-17880985 ATAATGCTCCATGAACAAGCAGG - Intronic
1163916784 19:20247068-20247090 ATAATGCTTTATGCACTTGGAGG - Intergenic
1163943216 19:20513855-20513877 ATAATGCTCCATGCACTTGGAGG + Intergenic
1163966378 19:20750847-20750869 ATAATGCTCCATGCACTTGAAGG + Intronic
1167942599 19:52959662-52959684 ATAATGCTTTATGCACTTGAAGG - Intronic
931698386 2:64889246-64889268 ATAAAGCCCCATGCACTTGGAGG + Intergenic
932030874 2:68183245-68183267 AAAATGCTCCATGTTCTTGTGGG + Intronic
932349940 2:71023576-71023598 ATCACGCTCCATGCACTTGAAGG - Intergenic
932353435 2:71049714-71049736 ATAATCCTCTACGCACTTGAAGG - Intergenic
933167726 2:79094262-79094284 ATGATGCTCCTTGCTTTTGAAGG + Intergenic
935886640 2:107627375-107627397 ATAATGCTCCACCTGCTTGAGGG + Intergenic
936725673 2:115312261-115312283 ATAATCTTCTAGGCACTTGAGGG - Intronic
938666549 2:133544560-133544582 ATAATACTCCATTCACACGATGG - Intronic
938935617 2:136125141-136125163 ATTATGTTCCATGCATTGGAAGG + Intergenic
940454175 2:153874304-153874326 AAAATTCTCCATGGAATTGAAGG - Intronic
940773695 2:157865121-157865143 ATAAAGCTCCATTTACTGGAAGG + Intronic
940869520 2:158848353-158848375 ATCACGCTCCATGCACTTGAAGG - Intronic
940872196 2:158869351-158869373 ATCACGCTCCATGCACTTGAAGG - Intergenic
940874403 2:158885339-158885361 ATCATGCTCCATGCACTTGAAGG - Intergenic
943016135 2:182512411-182512433 ATATTCTTTCATGCACTTGAGGG - Intronic
947594997 2:231405497-231405519 ATGATGCTTCATGCACTTGAAGG - Intergenic
1170024655 20:11875750-11875772 ATAATGCTCCAGGGAATGGAGGG - Intergenic
1171408541 20:24930215-24930237 ATAACGCTCCATGCACTTGAAGG - Intergenic
1174768877 20:53279759-53279781 ATAATGCTCTATTCCCTTCATGG - Intronic
1175665579 20:60856371-60856393 ATGATGCTCCATCAACTGGATGG + Intergenic
1178334236 21:31730243-31730265 ATAATGCTCCAAACATTTCAGGG - Intronic
1178447709 21:32660762-32660784 ATAATGCTCCATGCACTTGGAGG - Intronic
1181263208 22:21613565-21613587 ATGTTGTTCCTTGCACTTGACGG + Intronic
1184716730 22:46286882-46286904 AGACTGCTCCAAGCACTAGAGGG - Intronic
949158113 3:851124-851146 ACAATGCCCCATGCACTTGCAGG - Intergenic
949884559 3:8682937-8682959 ATCACGCTCCATGCACTTGAAGG - Intronic
952242665 3:31549055-31549077 TTAATGTTCCATGCAATTCATGG + Intronic
954292254 3:49655867-49655889 ATACTGGTCCATGGAGTTGAGGG - Exonic
954816332 3:53284254-53284276 ATAATGCAACATGAAATTGAAGG - Exonic
955683951 3:61531285-61531307 TAAATGCTTCATGCACTTGAAGG - Intergenic
957044394 3:75362743-75362765 ATCATGCTCCATGCACTTGAAGG + Intergenic
957076190 3:75604926-75604948 ATCATGCTCCATGCACTTGAAGG + Intergenic
957722532 3:84022344-84022366 ATAAAGTTCCATGAACTAGATGG + Intergenic
958872226 3:99573860-99573882 ATACTGCTCAAAGCAATTGATGG + Intergenic
960055804 3:113275644-113275666 AAAATGCTATGTGCACTTGATGG + Intronic
961272246 3:125698023-125698045 ATCACGCTCCATGCACTTGAAGG - Intergenic
961275109 3:125720256-125720278 ATCATGCTCCATGCACTTGAAGG - Intergenic
961318036 3:126053995-126054017 ATAATGATTCTTGCACTTGAGGG + Intronic
961876388 3:130026777-130026799 ATCATGCTCCATGCACTTGAAGG + Intergenic
961892849 3:130144934-130144956 ATAATGCTCCACGCACTTGAAGG + Intergenic
964522403 3:157583222-157583244 ATAATGCTCCATGCACTTGGAGG + Intronic
967394741 3:188995010-188995032 CAATTGCTACATGCACTTGATGG - Intronic
968932919 4:3592442-3592464 ATAATATTCCTTCCACTTGAAGG + Intergenic
968988659 4:3893983-3894005 ATCACACTCCATGCACTTGAAGG + Intergenic
969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG + Intergenic
969025249 4:4167572-4167594 ATCATGCTCCATGCACTTGAAGG + Intergenic
969646975 4:8436444-8436466 ATAATTCTCCATGCAGTTGGAGG - Intronic
969729473 4:8945539-8945561 ATCACGCTCCATGCACTTGAAGG - Intergenic
969734211 4:8976182-8976204 ATCACGCTCCATGCACTAGAAGG - Intergenic
969749914 4:9102207-9102229 ATAATGTTCCATGCACTAGAAGG - Intergenic
969793798 4:9510246-9510268 ATCACGCTCCATGTACTTGAAGG - Intergenic
972077468 4:35105221-35105243 ATAATGCCCCATGTACTTGAAGG - Intergenic
972387667 4:38583582-38583604 ATAATGCAACATGCACTTAAGGG - Intergenic
974073410 4:57146529-57146551 ATCATGGTCCCTGCCCTTGAAGG + Intergenic
977660338 4:99578219-99578241 AAAATTCTAAATGCACTTGAAGG + Intronic
979658301 4:123222981-123223003 ATAGTGCTGCATGAACGTGAGGG + Intronic
980390515 4:132140081-132140103 ATTATGCTCCATCTTCTTGAGGG - Intergenic
980780143 4:137483032-137483054 ATAATGCTCCATGCACTTGGAGG - Intergenic
982566345 4:156991860-156991882 ATGATGCTTGATCCACTTGAGGG - Intergenic
983132400 4:164037608-164037630 ATAATGCTCCATCTCTTTGAGGG - Intronic
985377908 4:189361474-189361496 AGAATACTGCATCCACTTGAGGG + Intergenic
993026650 5:82654653-82654675 ATTATGCTCCATGTAGTTTAGGG - Intergenic
994023814 5:95059101-95059123 ATAATGATATATGCACTTGTAGG + Intronic
995473826 5:112528628-112528650 ATAATGCTCCATGCACTTGGAGG - Intergenic
1002344879 5:178541770-178541792 ATGTTGCTGCATGCAGTTGAGGG - Intronic
1002408137 5:179052451-179052473 ATAATGCTCCGTGCACTTGGAGG + Intergenic
1003726004 6:8764948-8764970 TGAATGTTCCAAGCACTTGATGG + Intergenic
1007843352 6:44734677-44734699 AGTATTCTCCATGCACTTAAAGG + Intergenic
1008583082 6:52923723-52923745 ATAATTCTCCATGCACTTGGAGG - Intergenic
1009988460 6:70810891-70810913 ATTATGCTACATCCATTTGATGG - Intronic
1010705721 6:79107184-79107206 ATAATGCTTCATGTATTAGAAGG - Intergenic
1011565345 6:88666913-88666935 ATAATGCCCCATGCACTTGGAGG - Intronic
1012427944 6:99134762-99134784 CAAATGCTCCATGCCCTTGGTGG + Intergenic
1012434261 6:99198241-99198263 ATGATTCTCCAAGAACTTGAGGG - Intergenic
1012611695 6:101227164-101227186 ATAACACCCCATGCACTTGGAGG + Intergenic
1015215132 6:130741261-130741283 ATGATCCTCCATGCCCTGGATGG + Intergenic
1016118664 6:140320432-140320454 ATAATACTCTATTGACTTGAGGG - Intergenic
1019038268 6:169081035-169081057 AGAATGCCACATGCAATTGAAGG + Intergenic
1020307027 7:6843253-6843275 AGCATGCTCCATGCACTTAAAGG + Intergenic
1020311503 7:6872097-6872119 ATCACGCTCCATGCACTTGAAGG + Intergenic
1020323071 7:6954435-6954457 ATAATGCTCCATGCACTAGAAGG + Intergenic
1023106402 7:36767162-36767184 CTGATGCTTCATGCACTTGTGGG + Intergenic
1026553019 7:71383898-71383920 ATAATGCTCTATGAACATGCGGG + Intronic
1029078181 7:97952197-97952219 AGCATGCTCCATGCACTTGAAGG + Intergenic
1032170770 7:129582812-129582834 ATAATGCACCATGTACTTAGAGG - Intergenic
1036262050 8:7248848-7248870 ATCACACTCCATGCACTTGAAGG + Intergenic
1036304541 8:7590710-7590732 ATCACACTCCATGCACTTGAAGG - Intergenic
1036314089 8:7707387-7707409 ATCACACTCCATGCACTTGAAGG + Intergenic
1036355394 8:8038702-8038724 ATCACACTCCATGCACTTGAAGG - Intergenic
1036372993 8:8176547-8176569 ATAATGTTCCATGCATTTGAAGG - Intergenic
1036481937 8:9147791-9147813 ACAATGCTGCTGGCACTTGAAGG + Intronic
1036816612 8:11907312-11907334 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036833341 8:12038840-12038862 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036855187 8:12285405-12285427 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036877912 8:12489094-12489116 ATAATGTTCCATGCATTTGAAGG + Intergenic
1036903506 8:12689259-12689281 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036906005 8:12708938-12708960 ATCATGCTCCATGCACTTGAAGG + Intergenic
1038799122 8:30733355-30733377 ATAATGCTCCATGCACTTGAAGG - Intronic
1040061221 8:43104492-43104514 ATGATGGTCCATCCACTTGACGG + Intronic
1040513702 8:48117431-48117453 ATGATGCTCCCTGCTCTCGAGGG - Intergenic
1040812403 8:51469740-51469762 TTTATGCTCCATGCACTTTCAGG + Intronic
1041008995 8:53523260-53523282 ATAATGCTCCATGCACTTGGAGG + Intergenic
1041030930 8:53734550-53734572 ATAATGCCCCATGTACTTGGAGG - Intronic
1045110811 8:98938507-98938529 CCAATGCTGGATGCACTTGAAGG + Intronic
1047225643 8:122953570-122953592 GTACTGCTCCATCCACTTCACGG - Exonic
1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG + Intergenic
1052517163 9:29497112-29497134 AGAATGATCTATGAACTTGAGGG - Intergenic
1053026644 9:34734863-34734885 GTCATCCTCCATGCTCTTGATGG - Intergenic
1056061813 9:82891020-82891042 ATGAAGCTGCCTGCACTTGAGGG - Intergenic
1056122352 9:83501993-83502015 TTAATGATTCATGCACTTAAAGG - Intronic
1056865843 9:90226810-90226832 ATCACGCTCCATGCACTTGAAGG - Intergenic
1056917175 9:90756093-90756115 ATCATGCTCCATGCACTTGAAGG + Intergenic
1056939658 9:90944465-90944487 ACACTGCTCCATGCACCTGGAGG - Intergenic
1058179605 9:101780542-101780564 ATATTCCTCCAAGCATTTGACGG - Intergenic
1062224088 9:135439245-135439267 ATAATGCACCATGCACTTGAAGG + Intergenic
1185909960 X:3972165-3972187 ATAATGCTCCATGCACTTGGAGG - Intergenic
1187450580 X:19392780-19392802 ATAATGCTCTCTCAACTTGAGGG + Intronic
1189306630 X:39991728-39991750 TTTATGCTCTATGCTCTTGAAGG - Intergenic
1189644925 X:43117835-43117857 ATTATGCTCCATCACCTTGAGGG + Intergenic
1190425847 X:50333968-50333990 ATAATGTTCCATGCACTTGGAGG + Intronic
1191036037 X:56027460-56027482 ATAATGCCCCATGTACTTGAAGG + Intergenic
1193070212 X:77298574-77298596 AGAGTGCTCCATGCACTTGGAGG - Intergenic
1194255916 X:91633346-91633368 CTAATGCTCCAGGCTTTTGAGGG + Intergenic
1194400549 X:93434438-93434460 ATAATGCTCCATGCACTTGAAGG - Intergenic
1196788573 X:119443698-119443720 ATAATTCTCCATCAAGTTGAAGG - Intronic
1197647692 X:129035914-129035936 AGAATGCTCCATGAGCTTAAGGG + Intergenic
1198334523 X:135653569-135653591 CTAAAACTCCCTGCACTTGATGG - Intergenic
1198469643 X:136934403-136934425 TTAATTATCCATGCACTTGGAGG + Intergenic
1198970068 X:142269920-142269942 ATAATGCTCCGTGTACTTGAAGG - Intergenic
1200081916 X:153581441-153581463 AGAGTGCTTCATGCTCTTGAAGG - Exonic
1200394080 X:155972936-155972958 ATAATGCTCCATGCACTTGAAGG + Intergenic
1200574645 Y:4872616-4872638 CTAATGCTCCAGGCTTTTGAGGG + Intergenic
1200911766 Y:8537443-8537465 ATGTTGCTCCAGCCACTTGATGG - Intergenic
1200925301 Y:8648955-8648977 ATAATGCTCCATGCGCTTGGAGG - Intergenic
1200943379 Y:8807713-8807735 ATAATGCTCTATGCACATGGAGG - Intergenic
1200983609 Y:9284476-9284498 ATAATGCTCCATGTACTTGGAGG + Intergenic
1201555100 Y:15259012-15259034 ATAATGCTTCATGCACTTGAAGG - Intergenic
1201680514 Y:16640087-16640109 ATAATGCTCCATGTACTTGAAGG + Intergenic
1201696927 Y:16836231-16836253 ACAATGCTCCACGTACTTGAAGG - Intergenic
1202126759 Y:21575212-21575234 ATAATGCTCCATGTACTTGGAGG - Intergenic