ID: 1048957380

View in Genome Browser
Species Human (GRCh38)
Location 8:139548167-139548189
Sequence TGCTCCATGCACTTGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048957374_1048957380 11 Left 1048957374 8:139548133-139548155 CCCCAGAGTTCAATCGGCCCTTT No data
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data
1048957373_1048957380 12 Left 1048957373 8:139548132-139548154 CCCCCAGAGTTCAATCGGCCCTT No data
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data
1048957378_1048957380 -7 Left 1048957378 8:139548151-139548173 CCTTTTCTTTATATAATGCTCCA No data
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data
1048957377_1048957380 -6 Left 1048957377 8:139548150-139548172 CCCTTTTCTTTATATAATGCTCC 0: 14
1: 19
2: 24
3: 115
4: 735
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data
1048957375_1048957380 10 Left 1048957375 8:139548134-139548156 CCCAGAGTTCAATCGGCCCTTTT No data
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data
1048957376_1048957380 9 Left 1048957376 8:139548135-139548157 CCAGAGTTCAATCGGCCCTTTTC No data
Right 1048957380 8:139548167-139548189 TGCTCCATGCACTTGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048957380 Original CRISPR TGCTCCATGCACTTGAAGGA AGG Intergenic
No off target data available for this crispr