ID: 1048960884

View in Genome Browser
Species Human (GRCh38)
Location 8:139575808-139575830
Sequence CAATAGCAACAAGTGTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048960884_1048960886 9 Left 1048960884 8:139575808-139575830 CCTGGGTACACTTGTTGCTATTG No data
Right 1048960886 8:139575840-139575862 TTCTTTTTAGGCCCTTGACAAGG No data
1048960884_1048960885 -3 Left 1048960884 8:139575808-139575830 CCTGGGTACACTTGTTGCTATTG No data
Right 1048960885 8:139575828-139575850 TTGAAGTATCATTTCTTTTTAGG No data
1048960884_1048960887 14 Left 1048960884 8:139575808-139575830 CCTGGGTACACTTGTTGCTATTG No data
Right 1048960887 8:139575845-139575867 TTTAGGCCCTTGACAAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048960884 Original CRISPR CAATAGCAACAAGTGTACCC AGG (reversed) Intergenic
No off target data available for this crispr