ID: 1048964384

View in Genome Browser
Species Human (GRCh38)
Location 8:139604757-139604779
Sequence TGAGCCCTGGGTAGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048964374_1048964384 6 Left 1048964374 8:139604728-139604750 CCAGGGCTCACGCCCATCTGTTT 0: 1
1: 0
2: 0
3: 5
4: 204
Right 1048964384 8:139604757-139604779 TGAGCCCTGGGTAGGCCCTGGGG No data
1048964376_1048964384 -6 Left 1048964376 8:139604740-139604762 CCCATCTGTTTCCTGGATGAGCC 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1048964384 8:139604757-139604779 TGAGCCCTGGGTAGGCCCTGGGG No data
1048964377_1048964384 -7 Left 1048964377 8:139604741-139604763 CCATCTGTTTCCTGGATGAGCCC 0: 1
1: 0
2: 2
3: 32
4: 277
Right 1048964384 8:139604757-139604779 TGAGCCCTGGGTAGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048964384 Original CRISPR TGAGCCCTGGGTAGGCCCTG GGG Intronic
No off target data available for this crispr